New Tool in the Toolbox? Extra Material

What is a melt curve?

A melt curve is a visual representation of the temperature at which a certain piece of DNA separates to two single strands. Because of that, a piece of DNA (usually less than 250 base pairs for melt curve analysis) will melt at a higher temperature if there are more G’s and C’s and at a lower temperature if there are fewer. For our purposes, we are using the test more simply as a positive/negative to determine if there is berry DNA in the gut of a given spotted-wing drosophila sample.

example good melt curve
Example of a sample positive for the desired DNA sequence.
example good negative
Example of a QPCR melt curve output that is negative for the desired DNA sequence.

Primers Used

Organism Forward Primer Reverse Primer Publication or GenBank Entry
Drosophila suzukii
AATTGTTACCGCACATGC
GGAATGCTATATCTGGGTCC
Dhami and Kumarasinghe 2014
Blueberry
GGGCATTCTATGGGTTTTCA
TGGATCCTTCTTGGTTGAGC
GenBank: MK520790.1
Strawberry  & Rubus
GGATTCTTCCTGGTTGAGACC
CCGGCTACCTTATGGTTCTTC
Dong et al. 2015

 

  • The Drosophila suzukii or Spotted-wing drosophila primer is used in each test to confirm that the DNA extraction was successful. It will also be useful in confirming that visually identified suzukii are true to species when field-caught flies are tested.
  • The blueberry primer is likely broad enough to capture other plants within Ericaceae, but it does not pick up strawberry, blackberry, or raspberry varieties tested. Additionally, this primer has been tested on more than 5 varieties each of southern highbush and rabbiteye varieties and works for both types of blueberry.
  • This is the strawberry primer published in Diepenbrock et al. 2018 paper describing using the gut molecular technique in suzukii for the first time. Unfortunately, this primer is not specific only to strawberry. It picks up both raspberry and blackberry varieties I tested in the lab and pulls up Rubus sp in a BLAST search.

Question 1.

black larvae female 2.copyAdult D. suzukii were allowed to infest blueberries for 8 hours, then removed. Blueberries were held at 20 ⁰ C until larvae within pupated. Pupae were removed from blueberries and allowed to eclose in a clean petri dish with a damp paper towel. Within twelve hours of eclosion, adult D. suzukii were frozen then held in 96% ethanol until DNA was extracted following protocol in Diepenbrock et al. 2018.  15 adult male and 15 adult female flies were all negative for blueberry (yet positive for the D. suzukii primer control), as seen in the figure above.

Question 2.

D. suzukii were starved 72 hours on 5g white sugar in 400 mL water, then fed a blueberry puree made from organically grown berries with a small amount of white trap fluid all with labels.jpgsugar added. Live flies were dumped into each of the four liquids (apple cider vinegar, water with dish soap, ethylene glycol, and RV Antifreeze) to mimic the same manner that they would die in a trap in the field in case other issues (flies immediately vomiting gut contents) might affect the study.

Trap fluid was held at typical blueberry harvest temperature (see text box on next page) for up to seven days. Fluid was then drained through a fine mesh strainer. Adult flies were carefully scooped off of mesh and placed in 96% ethanol until DNA extraction.

blueberry harvest temperature

I would like to make the note that I was very shocked that the ‘water and dish soap’ treatment yielded intact DNA even at day 7. Anecdotally, flies starting at 4 days began to get engorged abdomens and become incredibly fragile. I had a hard time scooping them off the mesh without breaking off wings/legs (which could be important for identifying males and females) or breaking the entire fly open. Additionally, I practiced trapping flies in the field using RV fluid with a Scentry lure on top, and after heavy rain when water would get into the traps, the flies’ abdomens would become swollen. Anyone trying these methods may want to change out trap fluid for fresh after a significant rain event instead of straining the RV fluid into a new container to save reagent.

Finally, I think sunlight and UV rays may do more to break down DNA than the trap fluid and warm temperatures tested. I have one test that was placed outside in August to test this, but it was flies fed on raspberry, so I have to wait for a successful raspberry primer before I can test the results of that assay.

waterlogged with labels
These two photos of flies held for 7 days in their respective fluid were sized so that the circular container is the same size. Notice how engorged the flies in the water on the right are compared to those that look fresh on the left. The water was also dingy and smelled bad.

Question 3.

Flies fed on blueberry then held at 20⁰ C. Numbers are shown as flies with blueberry detected in gut over total flies tested.

0 Day 3 Day 5 Day 7 Day
Female 15/15 12/15 13/14 13/15
Male 12/15* 13/15 11/15 10/15

 

*Note that male flies don’t seem to feed as readily as females, even after starving for 72 hours as described above. Anecdotally, males are also the first to die when flies are held for periods longer than 72 hours. Potentially, berry feeding is less common among males, which I’d like to explore further.

Please, leave a comment/question below! Or write me on twitter @LauraJoanKraft

 

 

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s